Effect of Guizhi Fuling Capsule on Apoptosis of Myeloma Cells Through Mitochondrial Apoptosis Pathway / 中国结合医学杂志

OBJECTIVE@#To observe the effects of Guizhi Fuling Capsule (GZFLC) on myeloma cells and explore the mechanisms.@*METHODS@#MM1S and RPMI 8226 cells were co-cultured with different concentrations of serum and the cell experiments were divided into negative (10%, 20% and 40%) groups, GZFLC (10%, 20%, and 40%) groups and a control group. Cell counting kit-8 (CCK-8) assays and flow cytometry were used to detect the viability and apoptosis levels of myeloma cells. The effects on mitochondria were examined by reactive oxygen specie (ROS) and tetrechloro-tetraethylbenzimidazol carbocyanine iodide (JC-1) assays. Western blot was used to detect the expression of B cell lymphoma-2 (Bcl-2), Bcl-2-associated X (Bax), cleaved caspase-3, -9, cytochrome C (Cytc) and apoptotic protease-activating factor 1 (Apaf-1). RPMI 8226 cells (2 × 107) were subcutaneously inoculated into 48 nude mice to study the in vivo antitumor effects of GZFLC. The mice were randomly divided into four groups using a completely randomized design, the high-, medium-, or low-dose GZFLC (840, 420, or 210 mg/kg per day, respectively) or an equal volume of distilled water, administered daily for 15 days. The tumor volume changes in and survival times of the mice in the GZFLC-administered groups and a control group were observed. Cytc and Apaf-1 expression levels were detected by immunohistochemistry.@*RESULTS@#GZFLC drug serum decreased the viability and increased the apoptosis of myeloam cells (P<0.05). In addition, this drug increased the ROS levels and decreased the mitochondrial membrane potential (P<0.01). Western blot showed that the Bcl-2/Bax ratios were decreased in the GZFLC drug serum-treated groups, whereas the expression levels of cleaved caspase-3, -9, Cytc and Apaf-1 were increased (all P<0.01). Over time, the myeloma tumor volumes of the mice in the GZFLC-administered groups decreased, and survival time of the mice in the GZFLC-administered groups were longer than that of the mice in the control group. Immunohistochemical analysis of tumor tissues from the mice in the GZFLC-administered groups revealed that the Cytc and Apaf-1 expression levels were increased (P<0.05).@*CONCLUSION@#GZFLC promoted apoptosis of myeloma cells through the mitochondrial apoptosis pathway and significantly reduced the tumor volumes in mice with myeloma, which prolonged the survival times of the mice.

Research Advance of Autophagy in Acute Intestinal Graft-Versus-Host Disease--Review / 中国实验血液学杂志

Acute intestinal graft-versus-host disease is a refractory disease which can affect implantation and become a threat to life in severe cases. Autophagy is an intracellular degradation pathway necessary for maintaining cellular energy homeostasis. In recent years, a large number of studies have found that it is closely related to the pathogenesis and process of acute intestinal graft-versus-host disease. The main mechanisms may involve that inflammatory factor storm after pretreatment and infusion of donor cells induces disordered intestinal immune tolerance, and abnormal oxidative stress damages intestinal mucosal barrier, leading to intestinal rejection of acute graft-versus-host disease via mTOR signal pathway of autophagy, disordered mitophagy and other related pathways.

Neural mechanisms of visual feature binding / 生理学报

Integrating different visual features into a coherent object is a central challenge for the visual system, which is referred as the binding problem. Firstly, this review introduces the conception of the binding problem and the theoretical and empirical controversies regarding whether and how the binding processes are implemented in visual system. Although many neurons throughout the visual hierarchy are known to code multiple features, feature binding is recruited by visual system. Feature misbinding (or illusory conjunction) is probably the most striking evidence for the existence of the binding mechanism. Next, this review summarizes some critical issues in feature binding literature, including early binding theories, late binding theories, neural synchrony theory, the feature integration theory and re-entry processing theory. Feature binding is not a fully automatic or bottom-up processing. Reentrant connection from higher visual areas to early visual cortex (top-down processes) plays a critical role in feature binding, especially in active feature binding (i.e. feature misbinding). In addition, with electrophysiology, electroencephalography (EEG), magnetoencephalography (MEG) and transcranial electric stimulation (tEs) approaches, recent studies explored both correlational and causal relations between brain oscillations and feature binding, suggesting that brain oscillations are of great importance for feature binding. Finally, this review discusses some potential problems and open questions associated with visual feature binding mechanisms which need to be addressed in future studies.

Gene therapy and delivery strategies for ocular diseases / 药学学报

Gene therapy has obvious advantages in the treatment of ocular diseases due to the unique structure of the eye. In recent years, there are more and more therapeutic gene-based drugs for ophthalmic application in clinical trials. Most of the delivery vectors are adeno-associated virus and administered via intraocular injection, which has potential risks. Traditional remedies, such as topical instillationor systemic administration, have limited therapeutic effects on the diseases in the posterior segment of the eye, where the chemical drugs are hard to reach. This makes the research of new strategies for gene drug delivery extremely urgent. For better understanding of the latest hot topics of ocular gene therapy, this article is prepared to introduce application of gene therapy to the typical ocular diseases and the corresponding gene-based medicines. The absorption routes for gene delivery into eyes and existing barriers are summarized. Finally, the gene delivery strategies are highlighted. The clinical application of ocular gene therapy will be boosted by overcoming the absorbing barriers and reducing the potential pitfalls.

Association between endoplasmic reticulum stress pathway mediated by inositol-requiring kinase 1 and AECII apoptosis in preterm rats induced by hyperoxia / 中国当代儿科杂志

<p><b>OBJECTIVE</b>To study the association between endoplasmic reticulum stress (ERS) pathway mediated by inositol-requiring kinase 1 (IRE1) and the apoptosis of type II alveolar epithelial cells (AECIIs) exposed to hyperoxia.</p><p><b>METHODS</b>The primarily cultured AECIIs from preterm rats were devided into an air group and a hyperoxia group. The model of hyperoxia-induced cell injury was established. The cells were harvested at 24, 48, and 72 hours after hyperoxia exposure. An inverted phase-contrast microscope was used to observe morphological changes of the cells. Annexin V/PI double staining flow cytometry was performed to measure cell apoptosis. RT-PCR and Western blot were used to measure the mRNA and protein expression of glucose-regulated protein 78 (GRP78), IRE1, X-box binding protein-1 (XBP-1), and C/EBP homologous protein (CHOP). An immunofluorescence assay was performed to measure the expression of CHOP.</p><p><b>RESULTS</b>Over the time of hyperoxia exposure, the hyperoxia group showed irregular spreading and vacuolization of AECIIs. Compared with the air group, the hyperoxia group showed a significantly increased apoptosis rate of AECIIs and significantly increased mRNA and protein expression of GRP78, IRE1, XBP1, and CHOP compared at all time points (P<0.05). The hyperoxia group had significantly greater fluorescence intensity of CHOP than the air group at all time points. In the hyperoxia group, the protein expression of CHOP was positively correlated with the apoptosis rate of AECIIs and the protein expression of IRE1 and XBP1 (r=0.97, 0.85, and 0.88 respectively; P<0.05).</p><p><b>CONCLUSIONS</b>Hyperoxia induces apoptosis of AECIIs possibly through activating the IRE1-XBP1-CHOP pathway.</p>

Infection of the mononuclear cell subpopulations in murine bone marrow with murine cytomegalovirus / 中国实验血液学杂志

This study was aimed to explore the infection characteristics of murine mononuclear cell subpopulations in bone marrow with murine cytomegalovirus (MCMV). Subpopulations of mononuclear cells, including lin(+), lin(-), lin(-)CD117(+) and lin(-)CD117(-) cells, were infected with MCMV after being separated by MACS, and induced to differentiation by adding cytokines or inducer, then nucleic acid and proteins were detected. The results indicated that the MCMV DNA, IE transcripts and IE protein could be detected in the lin(+) cells infected with MCMV; no virus products were detected in infected lin(-) cells without adding any stimulating factors, while IE and E transcripts and proteins were detected after adding GM-CSF, rhEPO or phorbol ester in the lin(-) cells infected with MCMV. Furthermore, no IE or E gene transcripts were detected in the lin(-)CD117(+) and lin(-)CD117(-) cells, but the cell colony formation of lin(-)CD117(+) hematopoietic stem and progenitor cells was inhibited after MCMV infection and expression of CD117 antigen on cell surface of the lin(-) cells was downregulated. It is concluded that MCMV can latently infect subpopulations of mononuclear cells in the murine bone marrow. Cells which are of characteristics of primitive stem and progenitor cells are not susceptible to MCMV, but infection of these cells with MCMV can inhibit functions of cells and downregulate the expression of antigen on cells surface.

Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus / 中国实验血液学杂志

The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.